Tuesday, May 23, 2006

X-Men Divided

At last. The long-awaited X-Men marathon. The plan was to watch X-Men and X2: X-Men United Thursday, then go see X-Men: The Last Stand Friday. Unfortunately, it is surprisingly difficult to unite my party members. Therefore, many will miss out completely.

We are thus divided for the marathon. The new plan is to watch the first one in the afternoon at one person’s house, then the second one later at night at… my house? Only two or three of us will actually be there for all three. Hm. Not much of a party. Heck, it’s not even a marathon if you space them out, is it?

Anyway, hopefully I can pull together a big group to go to the theater Friday.

I just ripped the score onto my iTunes library. John Powell, huh? That took me by surprise. It should be awesome.

There is only one question you must ask… who will you stand with?

8 Comments:

Blogger Herr Vogler said...

How's the X-3 score?

word verification: vatncjdk

one of these days I'm hoping to get a word verifcation that reads like the following:

ctgatgacgactactgttacgctaatcgc

Friday, May 26, 2006 12:06:00 PM

 
Blogger the warrior bard said...

I've only given the score a once-over. I really wasn't that impressed. I mean, it fits the picture, but I would rather have heard some sort of development of the X2 score. That's what happens when you have a different composer for each installment, I guess... but Ottman's theme actually resembled Kamen's.

I guess that's my only complaint. It's too new. In itself, it's good to listen to. There's a distracting homage to Williams' Superman (the building timpani motive) that might bother you.

When it comes to Powell, I prefer what I call the "sacred tetralogy": The Bourne Identity, The Bourne Supremacy, The Italian Job, Paycheck.

That is... until The Bourne Ultimatum comes out to complete the Bourne trilogy.

Trilogies man. Now that X-Men is "done," I must turn my attention to Pirates of the Caribbean and Spider-Man.

Sunday, May 28, 2006 2:23:00 PM

 
Blogger Herr Vogler said...

mmm....Paycheck...The movie may not have been worth much but Mr. Powell's score is pretty good.

I remember listening to some of the X-3 score at iTunes and hearing that "distracting homage" to Superman. A little weird, I think. Perhaps, though, Mr. Powell was making fun of Mr. Ottman since he left X-Men to go to Superman (wouldn't you???)

Sunday, May 28, 2006 7:53:00 PM

 
Blogger Herr Vogler said...

X-3 was originally supposed to be scored by Lalo Schifrin (or as I prefer it, Lalo F%#king Schifrin, in a good way of course!).

Can you imagine how awesome that score would have been!?!?

Tuesday, May 30, 2006 10:58:00 AM

 
Blogger Mikey the Pikey said...

If Lalo really was supposed to score it, then that might explain why Powell had 10 fucking orchestrators (including 3 of the Fowlers if I read right). He must have not had much time...but as I understand it, he had the gig for at least three months, wtf?!!!

BTW, the movie's not as glamorous or as well made as X2, but it was a hell of a lot of fun (apparently $120 million worth of ticket buyers agreed with me).

word verify: xgena (dude!)

Tuesday, May 30, 2006 4:10:00 PM

 
Blogger Herr Vogler said...

Okay, just saw it. Not terrible. Actually, die Frau and I rather liked it. Rather nice and dark in some places.

Tim, I must unfortunately disagree with your initial assessment of JP's score. After listening pretty closely during the film (I still have yet to buy the score) I think that Powell and Ottman's music resembled each other at least stylistically. Both were colourful (heh) and I thought that the themes were rather similar at least in shape. I could be wrong, though; it's happened before...once.

Anyway. I did catch the distracting Superman-esque rhythmic motive in the film. Actually it wasn't -esque. It was downright stolen. That's okay, though. Steal from the best I always say (and have). Even if they aren't similar, Powell writes a better action sequence than Ottman (of course, as the Pikey mentioned, he had a gaggle of orchestrators and Ottman has more-or-less himself and Damon Intrabartolo. Didn't even have to look that up. Impressed aren't you? I knew you were.).

Overall, though, I thought it was a good effort for a score that was written in such a short time. I'm also very glad that both John Powell and Harry Gregson-Williams are able to get away from the Zimmer sound and compose a little more ably than certain other cough, Trevor Rabin, cough acolytes.

Tuesday, May 30, 2006 11:56:00 PM

 
Blogger the warrior bard said...

I meant the main themes from the first two sounded alike, and the third one didn't. Overall, the third one sounds like an X-Men score. I just wish John Ottman did it.

I also hope against hope that John Williams will return for at least one of the remaining Harry Potter films.

Wednesday, May 31, 2006 11:33:00 AM

 
Blogger Mikey the Pikey said...

Overall, there were two things that bugged me about the movie, 1: The wire work for some of the flying mutants was sub-par...and 2: That fly-by shot as the X-Jet zips by San Fran was God-awful...I can think of a few 80's TV shows that had better shots like that. And considering WETA did a lot of the work...WTF?!

I guess there is one more gripe about the film...Kelsey Grammar was fantastic casting as Beast, but some of his line deliveries were embarrassingly awful. It's funny, Singer said he didn't include Beast from the get-go because he thought he should be done full-CGI and the tech didn't (and likely wouldn't for a while) exist yet to really pull it off. Wonder if, in the end, the producers would've been better off standing behind that sentiment. Vinnie Jones was also a fantastic choice...but they should've CG-ed his body instead of putting him in a rubber muscle suit. Juggernaut should look like someone who's very image would make a normal person piss themselves.

I too would have liked to hear at least some allusion to previous thematic material in the main themes, but overall they were still pretty kick-ass. Will be buying the soundtrack shortly (which is saying something since I really had little desire to get the CD for X2!).

Wednesday, May 31, 2006 9:44:00 PM

 

<< Home